Dead miRNA entry

miRNA accession:
MI0015033
miRNA ID:
ppy-mir-526a-1
Forward to:
MI0015011
Comment:
Some annotated mir-518/519/526 family sequences collapse to the same loci in the P_pygmaeus_2.0.2 genome assembly. The entries are rationalised and merged.

Previous miRNA entry

Stem-loop sequence ppy-mir-526a-1

AccessionMI0015033 (change log)
DescriptionPongo pygmaeus miR-526a-1 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
         cu    c               a     ---    gu 
5' cucagg  guga ccucuagagggaagc cuuuc   ucuu  c
   ||||||  |||| ||||||||||||||| |||||   ||||   
3' gaguuu  cauu ggagauuucucuucg gaaag   agaa  u
         cu    a               c     aaa    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ppy-miR-526a

Accession MIMAT0015984
Sequence

15 - 

cucuagagggaagcacuuucu

 - 35

Get sequence
Evidence not experimental

References

1