Stem-loop sequence ppy-mir-523

AccessionMI0015030 (change log)
DescriptionPongo pygmaeus miR-523 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
        ugcu           g        a u    gucg  u 
5' ucucg    gugacccucua agggaagc c uucu    uc g
   |||||    ||||||||||| |||||||| | ||||    || a
3' agagu    cauugggaggu ucccuucg g aaga    ag a
        uucc           a        c c    --aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr19: 55474120-55474206 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-523
ppy-mir-520achr19: 55466122-55466202 [+]
ppy-mir-526bchr19: 55469606-55469691 [+]
ppy-mir-519bchr19: 55470705-55470789 [+]
ppy-mir-525chr19: 55473271-55473356 [+]
ppy-mir-523chr19: 55474120-55474206 [+]
ppy-mir-518f-1chr19: 55475773-55475859 [+]
ppy-mir-520bchr19: 55476981-55477041 [+]
ppy-mir-518f-2chr19: 55480152-55480238 [+]
ppy-mir-520cchr19: 55481357-55481443 [+]
ppy-mir-518cchr19: 55482645-55482745 [+]
Database links

Mature sequence ppy-miR-523

Accession MIMAT0015979
Sequence

53 - 

gaacgcgcuucccuauggagggu

 - 75

Get sequence
Evidence not experimental

References

1