Stem-loop sequence ppy-mir-520g

AccessionMI0015025 (change log)
DescriptionPongo pygmaeus miR-520g stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
        c  u     c         -        -----   g    u 
5' uccca gc gugac cucuagagg aagcacuu     ucu uuug u
   ||||| || ||||| ||||||||| ||||||||     ||| ||||  
3' agggu ug cauug gagauuucc uucgugaa     aga aggc g
        u  c     u         c        acaaa   g    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr19: 55494046-55494135 [+]
intergenic
chr19: 55497686-55497775 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-520g
ppy-mir-524chr19: 55484611-55484697 [+]
ppy-mir-517achr19: 55485875-55485961 [+]
ppy-mir-519dchr19: 55486957-55487041 [+]
ppy-mir-521-2chr19: 55490265-55490356 [+]
ppy-mir-520dchr19: 55491990-55492076 [+]
ppy-mir-517c-1chr19: 55492961-55493052 [+]
ppy-mir-520gchr19: 55494046-55494135 [+]
ppy-mir-517c-1chr19: 55496593-55496684 [+]
ppy-mir-520gchr19: 55497686-55497775 [+]
ppy-mir-516b-2chr19: 55501004-55501095 [+]
Database links

Mature sequence ppy-miR-520g

Accession MIMAT0015975
Sequence

55 - 

acaaagugcuucccuuuagagugu

 - 78

Get sequence
Evidence not experimental

References

1