Stem-loop sequence ppy-mir-520d

AccessionMI0015022 (change log)
DescriptionPongo pygmaeus miR-520d stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
        u          ua           c      --g  gu 
5' ucuca gcugugacuc  caaagggaagc cuuucu   uu  c
   ||||| ||||||||||  ||||||||||| ||||||   ||  u
3' agagu uggcauuggg  guuucucuucg gaaaga   aa  a
        u          ug           u      aaa  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr19: 55491990-55492076 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-520d
ppy-mir-518cchr19: 55482645-55482745 [+]
ppy-mir-524chr19: 55484611-55484697 [+]
ppy-mir-517achr19: 55485875-55485961 [+]
ppy-mir-519dchr19: 55486957-55487041 [+]
ppy-mir-521-2chr19: 55490265-55490356 [+]
ppy-mir-520dchr19: 55491990-55492076 [+]
ppy-mir-517c-1chr19: 55492961-55493052 [+]
ppy-mir-520gchr19: 55494046-55494135 [+]
ppy-mir-517c-1chr19: 55496593-55496684 [+]
ppy-mir-520gchr19: 55497686-55497775 [+]
ppy-mir-516b-2chr19: 55501004-55501095 [+]
Database links

Mature sequence ppy-miR-520d-5p

Accession MIMAT0015971
Sequence

16 - 

cuacaaagggaagcccuuuc

 - 35

Get sequence
Evidence not experimental

Mature sequence ppy-miR-520d-3p

Accession MIMAT0015972
Sequence

54 - 

aaagugcuucucuuuggugggu

 - 75

Get sequence
Evidence not experimental

References

1