Stem-loop sequence ppy-mir-519d

AccessionMI0015017 (change log)
DescriptionPongo pygmaeus miR-519d stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   ---  u  u     c   c       a      cc    u uuu 
5'    ca gc gugac cuc aaaggga gcacuu  uguu g   u
      || || ||||| ||| ||||||| ||||||  |||| |    
3'    gu ug cauug gag uuucccu cgugaa  acaa u   c
   agg  u  c     u   a       c      --    c ucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr19: 55486957-55487041 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-519d
ppy-mir-520bchr19: 55476981-55477041 [+]
ppy-mir-518f-2chr19: 55480152-55480238 [+]
ppy-mir-520cchr19: 55481357-55481443 [+]
ppy-mir-518cchr19: 55482645-55482745 [+]
ppy-mir-524chr19: 55484611-55484697 [+]
ppy-mir-517achr19: 55485875-55485961 [+]
ppy-mir-519dchr19: 55486957-55487041 [+]
ppy-mir-521-2chr19: 55490265-55490356 [+]
ppy-mir-520dchr19: 55491990-55492076 [+]
ppy-mir-517c-1chr19: 55492961-55493052 [+]
ppy-mir-520gchr19: 55494046-55494135 [+]
ppy-mir-517c-1chr19: 55496593-55496684 [+]
ppy-mir-520gchr19: 55497686-55497775 [+]
Database links

Mature sequence ppy-miR-519d

Accession MIMAT0015964
Sequence

51 - 

caaagugccucccuuuagagug

 - 72

Get sequence
Evidence not experimental

References

1