Stem-loop sequence ppy-mir-518a-1

AccessionMI0015006 (change log)
DescriptionPongo pygmaeus miR-518a-1 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
        u        u  g           c      guug  u 
5' ucuca gcugugac cu caaagggaagc cuuucu    uc a
   ||||| |||||||| || ||||||||||| ||||||    || a
3' agagu uggcauug ga guuucccuucg gaaaga    ag a
        u        u  g           c      --aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr19: 55505640-55505726 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-518a-1
ppy-mir-517c-1chr19: 55492961-55493052 [+]
ppy-mir-520gchr19: 55494046-55494135 [+]
ppy-mir-517c-1chr19: 55496593-55496684 [+]
ppy-mir-520gchr19: 55497686-55497775 [+]
ppy-mir-516b-2chr19: 55501004-55501095 [+]
ppy-mir-518echr19: 55504419-55504527 [+]
ppy-mir-518a-1chr19: 55505640-55505726 [+]
ppy-mir-516b-1chr19: 55511421-55511510 [+]
ppy-mir-520ichr19: 55513927-55514025 [+]
Database links

Mature sequence ppy-miR-518a-5p

Accession MIMAT0015951
Sequence

16 - 

cugcaaagggaagcccuuuc

 - 35

Get sequence
Evidence not experimental

Mature sequence ppy-miR-518a-3p

Accession MIMAT0015952
Sequence

53 - 

gaaagcgcuucccuuuggagug

 - 74

Get sequence
Evidence not experimental

References

1