Stem-loop sequence ppy-mir-515-2

AccessionMI0014998 (change log)
DescriptionPongo pygmaeus miR-515-2 stem-loop
Gene family MIPF0000020; mir-515
Literature search

1 open access papers mention ppy-mir-515-2
(2 sentences)

Stem-loop
        u     c  u           a    uu      gu 
5' ucuca gcagu au cuccaaaagaa gcac  ucuguu  c
   ||||| ||||| || ||||||||||| ||||  ||||||  u
3' agagu uguca ug gagguuuucuu cgug  agacga  g
        u     u  c           c    --      aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
NW_002965493.1: 1122-1204 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-515-2
ppy-mir-515-2NW_002965493.1: 1122-1204 [-]
ppy-mir-519eNW_002965493.1: 175-261 [-]
Database links

Mature sequence ppy-miR-515-5p

Accession MIMAT0015943
Sequence

14 - 

uucuccaaaagaaagcacuuucug

 - 37

Get sequence
Evidence not experimental

Mature sequence ppy-miR-515-3p

Accession MIMAT0015944
Sequence

51 - 

gagugccuucuuuuggagcguu

 - 72

Get sequence
Evidence not experimental

References

1