Stem-loop sequence ppy-mir-515-1

AccessionMI0014997 (change log)
DescriptionPongo pygmaeus miR-515-1 stem-loop
Gene family MIPF0000020; mir-515
Literature search

1 open access papers mention ppy-mir-515-1
(2 sentences)

Stem-loop
        u     c  u           a    uu      gu 
5' ucuca gcagu au cuccaaaagaa gcac  ucuguu  c
   ||||| ||||| || ||||||||||| ||||  ||||||  u
3' agagu uguca ug gagguuuucuu cgug  agacga  g
        u     u  c           c    --      aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr19: 55460257-55460339 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-515-1
ppy-mir-515-3chr19: 55453959-55454073 [+]
ppy-mir-519echr19: 55454916-55455002 [+]
ppy-mir-520fchr19: 55457107-55457193 [+]
ppy-mir-515-1chr19: 55460257-55460339 [+]
ppy-mir-526achr19: 55461733-55461798 [+]
ppy-mir-1283achr19: 55463738-55463824 [+]
ppy-mir-520achr19: 55466122-55466202 [+]
ppy-mir-526bchr19: 55469606-55469691 [+]
Database links

Mature sequence ppy-miR-515-5p

Accession MIMAT0015943
Sequence

14 - 

uucuccaaaagaaagcacuuucug

 - 37

Get sequence
Evidence not experimental

Mature sequence ppy-miR-515-3p

Accession MIMAT0015944
Sequence

51 - 

gagugccuucuuuuggagcguu

 - 72

Get sequence
Evidence not experimental

References

1