Dead miRNA entry

miRNA accession:
MI0014995
miRNA ID:
ppy-mir-514-2
Forward to:
MI0014994
Comment:
The 3 annotated mir-514 sequences map to just 1 locus in the P_pygmaeus_2.0.2 genome assembly. The entries are rationalised and merged.

Previous miRNA entry

Stem-loop sequence ppy-mir-514-2

AccessionMI0014995 (change log)
DescriptionPongo pygmaeus miR-514-2 stem-loop
Gene family MIPF0000130; mir-506
Stem-loop
   gu    -    g   c      -     a   g      u  gua 
5'   uguc ugug uac cuacuc uggag gug caauca gu   a
     |||| |||| ||| |||||| ||||| ||| |||||| ||    
3'   acag acgc aug gaugag gucuc cac guuagu ua   u
   -c    u    a   a      u     -   a      u  aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ppy-miR-514

Accession MIMAT0015942
Sequence

54 - 

auugacaccucugugaguaga

 - 74

Get sequence
Evidence not experimental

References

1