Stem-loop sequence ppy-mir-513b

AccessionMI0014992 (change log)
DescriptionPongo pygmaeus miR-513b stem-loop
Gene family MIPF0000130; mir-506
Stem-loop
   --g      g   c    a          u         gaa 
5'    uguaca ugc uuuc caaggaggug cauuuaugu   c
      |||||| ||| |||| |||||||||| |||||||||    
3'    acaugu aug gaag guuuuuccac guaaaugua   u
   acg      a   a    a          u         aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chrX: 147086781-147086864 [-]
intergenic
Database links

Mature sequence ppy-miR-513b

Accession MIMAT0015940
Sequence

14 - 

uucacaaggaggugucauuuau

 - 35

Get sequence
Evidence not experimental

References

1