Stem-loop sequence ppy-mir-513a-1

AccessionMI0014990 (change log)
DescriptionPongo pygmaeus miR-513a-1 stem-loop
Gene family MIPF0000130; mir-506
Stem-loop
               --u   -c   u ag      g   c    a   gg     uc        gaa 
5' gggaugccacau   cag  cau c  uguaca ugc uuuc cag  aggug  auuuaugu   c
   ||||||||||||   |||  ||| |  |||||| ||| |||| |||  |||||  ||||||||    
3' cccuguggugua   guc  gua g  acaugu aug gaag guc  uccac  uaaauaua   u
               uac   ac   c --      a   a    a   uu     uc        aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chrX: 147101263-147101391 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-513a-1
ppy-mir-513a-2chrX: 147110689-147110815 [-]
ppy-mir-513a-1chrX: 147101263-147101391 [-]
Database links

Mature sequence ppy-miR-513a-5p

Accession MIMAT0015938
Sequence

37 - 

uucacagggaggugucau

 - 54

Get sequence
Evidence not experimental

Mature sequence ppy-miR-513a-1-3p

Accession MIMAT0015939
Sequence

72 - 

uaaaucucaccuuucugagaag

 - 93

Get sequence
Evidence not experimental

References

1