Stem-loop sequence ppy-mir-498

AccessionMI0014971 (change log)
DescriptionPongo pygmaeus miR-498 stem-loop
Gene family MIPF0000463; mir-498
Stem-loop
   --aacccuccuugggaa  gaag            -         -a     c       ugua 
5'                  gu    cucaggcuguga uuucaagcc  ggggg guuuuuc    a
                    ||    |||||||||||| |||||||||  ||||| |||||||    c
3'                  cg    gaguuugacacu gaaguucgg  ccucc cgaaaag    u
   uugaagcaaucugcuaa  ---a            c         ga     a       uagg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr19: 55448578-55448701 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-498
ppy-mir-512-1chr19: 55442498-55442581 [+]
ppy-mir-512-2chr19: 55444850-55444947 [+]
ppy-mir-1323chr19: 55446306-55446378 [+]
ppy-mir-498chr19: 55448578-55448701 [+]
ppy-mir-520echr19: 55450076-55450162 [+]
ppy-mir-515-3chr19: 55453959-55454073 [+]
ppy-mir-519echr19: 55454916-55455002 [+]
ppy-mir-520fchr19: 55457107-55457193 [+]
Database links

Mature sequence ppy-miR-498

Accession MIMAT0015919
Sequence

34 - 

uuucaagccagggggcguuuuuc

 - 56

Get sequence
Evidence not experimental

References

1