Stem-loop sequence ppy-mir-495

AccessionMI0014968 (change log)
DescriptionPongo pygmaeus miR-495 stem-loop
Gene family MIPF0000110; mir-329
Stem-loop
   ---    u          u  -       au     - uuu 
5'    uacc gaaaagaagu gc ccauguu  uuucg c   a
      |||| |||||||||| || |||||||  ||||| |   u
3'    augg uuuuucuuca cg gguacaa  aaagc g   a
   acu    c          -  u       ac     a ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 102595205-102595283 [+]
intergenic
NW_002955896.1: 4688-4766 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-495
ppy-mir-380chr14: 102586431-102586490 [+]
ppy-mir-1197chr14: 102586977-102587064 [+]
ppy-mir-323chr14: 102587145-102587230 [+]
ppy-mir-758chr14: 102587434-102587521 [+]
ppy-mir-329-1chr14: 102588199-102588278 [+]
ppy-mir-329-2chr14: 102588514-102588596 [+]
ppy-mir-494chr14: 102591073-102591153 [+]
ppy-mir-1193chr14: 102591485-102591597 [+]
ppy-mir-543chr14: 102593436-102593513 [+]
ppy-mir-495chr14: 102595205-102595283 [+]
ppy-mir-376cchr14: 102601818-102601883 [+]
ppy-mir-376a-2chr14: 102602202-102602281 [+]
ppy-mir-654chr14: 102602352-102602432 [+]
ppy-mir-376bchr14: 102602569-102602668 [+]
ppy-mir-376a-1chr14: 102602915-102602982 [+]
ppy-mir-300chr14: 102603492-102603574 [+]
ppy-mir-1185-1chr14: 102605109-102605194 [+]
Database links

Mature sequence ppy-miR-495

Accession MIMAT0015916
Sequence

47 - 

aaacaaacauggugcacuucuu

 - 68

Get sequence
Evidence not experimental

References

1