Stem-loop sequence ppy-mir-489

AccessionMI0014962 (change log)
DescriptionPongo pygmaeus miR-489 stem-loop
Gene family MIPF0000111; mir-489
Stem-loop
          c     g            gc c    ua     a 
5' guggcag uuggu gucguaugugug  g cauu  cuuga c
   ||||||| ||||| ||||||||||||  | ||||  |||||  
3' caucguc aaucg cggcauauacac  c guga  ggauu c
          a     a            ua a    --     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr7: 82622602-82622685 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-489
ppy-mir-489chr7: 82622602-82622685 [+]
ppy-mir-653chr7: 82623685-82623780 [+]
Database links

Mature sequence ppy-miR-489

Accession MIMAT0015908
Sequence

52 - 

gugacaucacauauacggcagc

 - 73

Get sequence
Evidence not experimental

References

1