Stem-loop sequence ppy-mir-488

AccessionMI0014961 (change log)
DescriptionPongo pygmaeus miR-488 stem-loop
Gene family MIPF0000318; mir-488
Stem-loop
       a      cu  c   u      a  c        g u 
5' gaga ucaucu  cc aga aauggc cu ucaaacaa u u
   |||| ||||||  || ||| |||||| || |||||||| | c
3' cucu aguaga  gg ucu uuaucg ga aguuuguu a c
       c      cu  u   -      -  a        g a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 73870648-73870730 [+]
intergenic
Database links

Mature sequence ppy-miR-488

Accession MIMAT0015907
Sequence

52 - 

uugaaaggcuauuucuugguc

 - 72

Get sequence
Evidence not experimental

References

1