Stem-loop sequence ppy-mir-451

Accession MI0014952
Description Pongo pygmaeus miR-451 stem-loop
Gene family MIPF0000148; mir-451
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-451_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-451 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. miR-451 regulates the drug-transporter protein P-glycoprotein, potentially promoting resistance to the chemotherapy drug Paclitaxel.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c     a        ga                 a 
 uuggg auggcaag  aaccguuaccauuacug g
 ||||| ||||||||  |||||||||||||||||  
 gaccc uaucguuc  uugguaaugguaaugau u
a     a        uc                 u 
Get sequence
Genome context
Coordinates (PPYG2) Overlapping transcripts
17: 23605620-23605691 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-451
ppy-mir-144 17: 23605784-23605869 [-]
ppy-mir-451 17: 23605620-23605691 [-]

Mature sequence ppy-miR-451

Accession MIMAT0015896
Sequence

17 - 

aaaccguuaccauuacugaguu

 - 38

Get sequence
Evidence not experimental

References

1