Stem-loop sequence ppy-mir-451

AccessionMI0014952 (change log)
DescriptionPongo pygmaeus miR-451 stem-loop
Gene family MIPF0000148; mir-451
Stem-loop
   c     a        ga                 a 
5'  uuggg auggcaag  aaccguuaccauuacug g
    ||||| ||||||||  |||||||||||||||||  
3'  gaccc uaucguuc  uugguaaugguaaugau u
   a     a        uc                 u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr17: 23605620-23605691 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-451
ppy-mir-144chr17: 23605784-23605869 [-]
ppy-mir-451chr17: 23605620-23605691 [-]
Database links

Mature sequence ppy-miR-451

Accession MIMAT0015896
Sequence

17 - 

aaaccguuaccauuacugaguu

 - 38

Get sequence
Evidence not experimental

References

1