Stem-loop sequence ppy-mir-448

AccessionMI0014946 (change log)
DescriptionPongo pygmaeus miR-448 stem-loop
Gene family MIPF0000149; mir-448
Stem-loop
   -----------  c       u a            g   u     ga au    auu  au 
5'            gc gggaggu g acauccugcaua ugc gccag  a  cccu   uc  a
              || ||||||| | |||||||||||| ||| |||||  |  ||||   ||   
3'            cg cccucua c uguaggauguau acg ugguc  u  gggg   ag  u
   acugcuucacc  a       c c            -   u     gg cg    ---  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chrX: 113777748-113777858 [+]
intergenic
Database links

Mature sequence ppy-miR-448

Accession MIMAT0015890
Sequence

71 - 

uugcauauguaggaugucccau

 - 92

Get sequence
Evidence not experimental

References

1