Stem-loop sequence ppy-mir-425

AccessionMI0014941 (change log)
DescriptionPongo pygmaeus miR-425 stem-loop
Gene family MIPF0000242; mir-425
Stem-loop
        c  u    aau        cacucccguugagugggc 
5' gaaag gc uugg   gacacgau                  a
   ||||| || ||||   ||||||||                  c
3' cuuuc cg gacc   cugugcug                  c
        u  u    cgc        uaagggcuaccgaagagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr3: 97473537-97473623 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-425
ppy-mir-191chr3: 97473062-97473153 [+]
ppy-mir-425chr3: 97473537-97473623 [+]
Database links

Mature sequence ppy-miR-425

Accession MIMAT0015885
Sequence

14 - 

aaugacacgaucacucccguuga

 - 36

Get sequence
Evidence not experimental

References

1