Stem-loop sequence ppy-mir-424

AccessionMI0014940 (change log)
DescriptionPongo pygmaeus miR-424 stem-loop
Gene family MIPF0000164; mir-322
Stem-loop
   ---------------------       a  c      aa             g   u 
5'                      cgagggg ua agcagc  uucauguuuugaa ugu c
                        ||||||| || ||||||  ||||||||||||| ||| u
3'                      gcucccc au ucgucg  gagugcaaaacuu gua a
   gggguggaagauggaaggggu       c  a      cg             g   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chrX: 134005869-134005966 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-424
ppy-mir-424chrX: 134005869-134005966 [-]
ppy-mir-503chrX: 134005583-134005653 [-]
ppy-mir-542chrX: 134000586-134000681 [-]
ppy-mir-450a-2chrX: 133999749-133999848 [-]
ppy-mir-450a-1chrX: 133999582-133999672 [-]
ppy-mir-450bchrX: 133999430-133999507 [-]
Database links

Mature sequence ppy-miR-424

Accession MIMAT0015884
Sequence

11 - 

cagcagcaauucauguuuugaa

 - 32

Get sequence
Evidence not experimental

References

1