Stem-loop sequence ppy-mir-383

AccessionMI0014931 (change log)
DescriptionPongo pygmaeus miR-383 stem-loop
Gene family MIPF0000137; mir-383
Stem-loop
      -c  a      aa    a        uug   gga 
5' cuc  uc gaucag  ggug uuguggcu   ggu   u
   |||  || ||||||  |||| ||||||||   |||    
3' gag  ag cugguc  ucac gacaccga   cua   a
      aa  a      cg    -        ---   auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr8: 14124271-14124343 [-]
intergenic
Database links

Mature sequence ppy-miR-383

Accession MIMAT0015873
Sequence

7 - 

agaucagaaggugauuguggcu

 - 28

Get sequence
Evidence not experimental

References

1