Stem-loop sequence ppy-mir-382

AccessionMI0014930 (change log)
DescriptionPongo pygmaeus miR-382 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
       u       -a           ug     ccuuua 
5' uacu gaagaga  guuguucgugg  gauuc      c
   |||| |||||||  |||||||||||  |||||       
3' auga cuuuuuu  caacaggcacu  cuaag      u
       -       ca           ua     caguau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 102616490-102616565 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-382
ppy-mir-381chr14: 102608058-102608132 [+]
ppy-mir-487bchr14: 102608591-102608674 [+]
ppy-mir-539chr14: 102609453-102609530 [+]
ppy-mir-889chr14: 102610033-102610111 [+]
ppy-mir-544chr14: 102610806-102610896 [+]
ppy-mir-655chr14: 102611698-102611794 [+]
ppy-mir-487achr14: 102614611-102614690 [+]
ppy-mir-382chr14: 102616490-102616565 [+]
ppy-mir-134chr14: 102616871-102616943 [+]
ppy-mir-668chr14: 102617958-102618024 [+]
ppy-mir-485chr14: 102618120-102618192 [+]
ppy-mir-453chr14: 102618891-102618970 [+]
ppy-mir-154chr14: 102622472-102622555 [+]
ppy-mir-496chr14: 102623301-102623402 [+]
ppy-mir-377chr14: 102624784-102624852 [+]
Database links

Mature sequence ppy-miR-382

Accession MIMAT0015872
Sequence

11 - 

gaaguuguucgugguggauucc

 - 32

Get sequence
Evidence not experimental

References

1