Stem-loop sequence ppy-mir-376c

AccessionMI0014924 (change log)
DescriptionPongo pygmaeus miR-376c stem-loop
Gene family MIPF0000091; mir-368
Stem-loop
       g     ua     u         uguua 
5' aaaa gugga  uuccu cuauguuua     u
   |||| |||||  ||||| |||||||||     u
3' uuuu caccu  aagga gauacaaau     u
       g     ua     -         uggua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 102601818-102601883 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-376c
ppy-mir-543chr14: 102593436-102593513 [+]
ppy-mir-495chr14: 102595205-102595283 [+]
ppy-mir-376cchr14: 102601818-102601883 [+]
ppy-mir-376a-2chr14: 102602202-102602281 [+]
ppy-mir-654chr14: 102602352-102602432 [+]
ppy-mir-376bchr14: 102602569-102602668 [+]
ppy-mir-376a-1chr14: 102602915-102602982 [+]
ppy-mir-300chr14: 102603492-102603574 [+]
ppy-mir-1185-1chr14: 102605109-102605194 [+]
ppy-mir-1185-2chr14: 102606330-102606415 [+]
ppy-mir-381chr14: 102608058-102608132 [+]
ppy-mir-487bchr14: 102608591-102608674 [+]
ppy-mir-539chr14: 102609453-102609530 [+]
ppy-mir-889chr14: 102610033-102610111 [+]
ppy-mir-544chr14: 102610806-102610896 [+]
ppy-mir-655chr14: 102611698-102611794 [+]
Database links

Mature sequence ppy-miR-376c

Accession MIMAT0015866
Sequence

43 - 

aacauagaggaaauuccacgu

 - 63

Get sequence
Evidence not experimental

References

1