Stem-loop sequence ppy-mir-376a-1

AccessionMI0014921 (change log)
DescriptionPongo pygmaeus miR-376a-1 stem-loop
Gene family MIPF0000091; mir-368
Stem-loop
   u    g  a    c    u      --gua   u 
5'  aaaa gu gauu uccu cuauga     cau a
    |||| || |||| |||| ||||||     ||| u
3'  uuuu ca cuaa agga gauacu     gua u
   c    g  c    a    -      aauua   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 102602915-102602982 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-376a-1
ppy-mir-543chr14: 102593436-102593513 [+]
ppy-mir-495chr14: 102595205-102595283 [+]
ppy-mir-376cchr14: 102601818-102601883 [+]
ppy-mir-376a-2chr14: 102602202-102602281 [+]
ppy-mir-654chr14: 102602352-102602432 [+]
ppy-mir-376bchr14: 102602569-102602668 [+]
ppy-mir-376a-1chr14: 102602915-102602982 [+]
ppy-mir-300chr14: 102603492-102603574 [+]
ppy-mir-1185-1chr14: 102605109-102605194 [+]
ppy-mir-1185-2chr14: 102606330-102606415 [+]
ppy-mir-381chr14: 102608058-102608132 [+]
ppy-mir-487bchr14: 102608591-102608674 [+]
ppy-mir-539chr14: 102609453-102609530 [+]
ppy-mir-889chr14: 102610033-102610111 [+]
ppy-mir-544chr14: 102610806-102610896 [+]
ppy-mir-655chr14: 102611698-102611794 [+]
Database links

Mature sequence ppy-miR-376a

Accession MIMAT0015864
Sequence

44 - 

aucauagaggaaaauccacgu

 - 64

Get sequence
Evidence not experimental

References

1