Stem-loop sequence ppy-mir-342

AccessionMI0014905 (change log)
DescriptionPongo pygmaeus miR-342 stem-loop
Gene family MIPF0000190; mir-342
Stem-loop
   gaaac     u        g      --ua      auuga      ugg  a 
5'      ugggc caagguga gggugc    ucugug     gggaca   uu a
        ||||| |||||||| ||||||    ||||||     ||||||   ||  
3'      auccg guuccacu cccacg    agacac     cucugu   ag u
   -auuc     -        g      cuaa      ----a      -ua  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 101636286-101636384 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-342
ppy-mir-151bchr14: 101636045-101636154 [-]
ppy-mir-342chr14: 101636286-101636384 [+]
Database links

Mature sequence ppy-miR-342-5p

Accession MIMAT0015844
Sequence

19 - 

aggggugcuaucugugauuga

 - 39

Get sequence
Evidence not experimental

Mature sequence ppy-miR-342-3p

Accession MIMAT0015845
Sequence

61 - 

ucucacacagaaaucgcacccgu

 - 83

Get sequence
Evidence not experimental

References

1