Stem-loop sequence ppy-mir-340

AccessionMI0014904 (change log)
DescriptionPongo pygmaeus miR-340 stem-loop
Gene family MIPF0000191; mir-340
Stem-loop
   --uu     u      au       -caa      u    g     ug 
5'     guauc ggugug  uauaaag    ugagac gauu ucaua  u
       ||||| ||||||  |||||||    |||||| |||| |||||  c
3'     uaugg ccauac  auauuuc    acucug cuag ggugu  g
   auuc     u      cg       auug      c    -     uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr5: 182637250-182637344 [-]
intergenic
Database links

Mature sequence ppy-miR-340

Accession MIMAT0015843
Sequence

16 - 

uuauaaagcaaugagacugauu

 - 37

Get sequence
Evidence not experimental

References

1