Stem-loop sequence ppy-mir-339

AccessionMI0014903 (change log)
DescriptionPongo pygmaeus miR-339 stem-loop
Gene family MIPF0000193; mir-339
Stem-loop
   ----------c       c    cu -      c  -c   a       u  g 
5'            ggggcgg cgcu  c ccuguc uc  agg gcucacg gu c
              ||||||| ||||  | |||||| ||  ||| ||||||| ||  
3'            ccccgcc gcgg  g ggacag ag  ucc cgagugu cg c
   cgcgucuguga       c    cc a      c  cu   g       c  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr7: 906035-906130 [-]
intergenic
Database links

Mature sequence ppy-miR-339-5p

Accession MIMAT0015842
Sequence

15 - 

ucccuguccuccaggagcucacg

 - 37

Get sequence
Evidence not experimental

References

1