Stem-loop sequence ppy-mir-338

AccessionMI0014902 (change log)
DescriptionPongo pygmaeus miR-338 stem-loop
Gene family MIPF0000097; mir-338
Stem-loop
      c      u   -         -   gauga 
5' ucu caacaa auc cuggugcug agu     c
   ||| |||||| ||| ||||||||| |||     u
3' aga guuguu uag gacuacgac uca     c
      a      u   u         c   acgga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr17: 71204205-71204271 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-338
ppy-mir-1250chr17: 71211623-71211734 [-]
ppy-mir-338chr17: 71204205-71204271 [-]
Database links

Mature sequence ppy-miR-338-5p

Accession MIMAT0015840
Sequence

6 - 

aacaauauccuggugcugagug

 - 27

Get sequence
Evidence not experimental

Mature sequence ppy-miR-338-3p

Accession MIMAT0015841
Sequence

42 - 

uccagcaucagugauuuuguug

 - 63

Get sequence
Evidence not experimental

References

1