Stem-loop sequence ppy-mir-337

AccessionMI0014901 (change log)
DescriptionPongo pygmaeus miR-337 stem-loop
Gene family MIPF0000195; mir-337
Stem-loop
   guagucagua uu         -   c   u     c        -   ca 
5'           g  ggggggugg gaa ggc ucaua aggaguug aug  c
             |  ||||||||| ||| ||| ||||| |||||||| |||   
3'           c  uccccuacu cuu ccg aguau uccucgac uau  a
   --------aa -u         u   u   u     a        c   ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 102419848-102419940 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-337
ppy-mir-493chr14: 102415715-102415803 [+]
ppy-mir-337chr14: 102419848-102419940 [+]
ppy-mir-431chr14: 102426387-102426500 [+]
ppy-mir-433chr14: 102427266-102427358 [+]
ppy-mir-127chr14: 102428359-102428455 [+]
Database links

Mature sequence ppy-miR-337-5p

Accession MIMAT0015838
Sequence

23 - 

gaacggcuucauacaggaguu

 - 43

Get sequence
Evidence not experimental

Mature sequence ppy-miR-337-3p

Accession MIMAT0015839
Sequence

61 - 

cuccuauaugaugccuuucuuc

 - 82

Get sequence
Evidence not experimental

References

1