Stem-loop sequence ppy-mir-335

AccessionMI0014900 (change log)
DescriptionPongo pygmaeus miR-335 stem-loop
Gene family MIPF0000196; mir-335
Stem-loop
   ----------uuu    c        a         c        u  gu 
5'              ugag ggggguca gagcaauaa gaaaaaug uu  c
                |||| |||||||| ||||||||| |||||||| ||   
3'              acuc ccuccagu cucguuauu cuuuuugc aa  a
   acuuauaucguuu    u        c         a        c  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr7: 127452363-127452454 [+]
intergenic
chr7: 127454360-127454451 [+]
intergenic
Database links

Mature sequence ppy-miR-335

Accession MIMAT0015837
Sequence

14 - 

ucaagagcaauaacgaaaaaugu

 - 36

Get sequence
Evidence not experimental

References

1