Stem-loop sequence ppy-mir-331

AccessionMI0014899 (change log)
DescriptionPongo pygmaeus miR-331 stem-loop
Gene family MIPF0000199; mir-331
Literature search

1 open access papers mention ppy-mir-331
(2 sentences)

Stem-loop
   gaguuu   uu        uuuguucuagguauggucccagggau 
5'       ggu  uguuuggg                          c
         |||  ||||||||                          c
3'       cca  acaaaucc                          c
   ---aau   --        uauccggguccccggaccaaacuaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr12: 96460018-96460105 [+]
intergenic
Database links

Mature sequence ppy-miR-331-5p

Accession MIMAT0015835
Sequence

26 - 

cuagguauggucccagggaucc

 - 47

Get sequence
Evidence not experimental

Mature sequence ppy-miR-331-3p

Accession MIMAT0015836
Sequence

61 - 

gccccugggccuauccua

 - 78

Get sequence
Evidence not experimental

References

1