Stem-loop sequence ppy-mir-330

AccessionMI0014898 (change log)
DescriptionPongo pygmaeus miR-330 stem-loop
Gene family MIPF0000200; mir-330
Stem-loop
   cuuu   -  u a           --    -    u   ag    ugcaa 
5'     ggc ga c cugccucucug  ggcc ugug cuu  gcuc     g
       ||| || | |||||||||||  |||| |||| |||  ||||     a
3'     ccg cu g gacggagagac  ccgg acac gaa  cgag     u
   ---c   u  c c           gu    c    -   -a    ccaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr19: 46914859-46914952 [-]
intergenic
Database links

Mature sequence ppy-miR-330-5p

Accession MIMAT0015833
Sequence

18 - 

ucucugggccugugucuuaggc

 - 39

Get sequence
Evidence not experimental

Mature sequence ppy-miR-330-3p

Accession MIMAT0015834
Sequence

57 - 

gcaaagcacacggccugcagaga

 - 79

Get sequence
Evidence not experimental

References

1