Stem-loop sequence ppy-mir-329-2

AccessionMI0014897 (change log)
DescriptionPongo pygmaeus miR-329-2 stem-loop
Gene family MIPF0000110; mir-329
Stem-loop
   g      cu           uu ug   uuc      u  au 
5'  ugguac  gaagagagguu  c  ggu   uguuuc uu  u
    ||||||  |||||||||||  |  |||   |||||| ||   
3'  acuaug  cuuuucuccaa  g  cca   acaaag ag  g
   -      ac           uu gu   --c      u  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 102588514-102588596 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-329-2
ppy-mir-379chr14: 102583478-102583544 [+]
ppy-mir-411chr14: 102584737-102584832 [+]
ppy-mir-299chr14: 102585203-102585265 [+]
ppy-mir-380chr14: 102586431-102586490 [+]
ppy-mir-1197chr14: 102586977-102587064 [+]
ppy-mir-323chr14: 102587145-102587230 [+]
ppy-mir-758chr14: 102587434-102587521 [+]
ppy-mir-329-1chr14: 102588199-102588278 [+]
ppy-mir-329-2chr14: 102588514-102588596 [+]
ppy-mir-494chr14: 102591073-102591153 [+]
ppy-mir-1193chr14: 102591485-102591597 [+]
ppy-mir-543chr14: 102593436-102593513 [+]
ppy-mir-495chr14: 102595205-102595283 [+]
Database links

Mature sequence ppy-miR-329

Accession MIMAT0015832
Sequence

52 - 

aacacaccugguuaaccucuuu

 - 73

Get sequence
Evidence not experimental

References

1