Stem-loop sequence ppy-mir-328

AccessionMI0014895 (change log)
DescriptionPongo pygmaeus miR-328 stem-loop
Gene family MIPF0000203; mir-328
Stem-loop
   --u  ag           -    a  u     a aaa  g 
5'    gg  ugggggggcag gagg gc caggg g   gu c
      ||  ||||||||||| |||| || ||||| |   ||  
3'    cc  gccuucccguc cucc cg guccc c   cg a
   guc  cu           u    -  -     - -ga  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr16: 54564958-54565032 [-]
intergenic
Database links

Mature sequence ppy-miR-328

Accession MIMAT0015831
Sequence

48 - 

cuggcccucucugcccuuccgu

 - 69

Get sequence
Evidence not experimental

References

1