Stem-loop sequence ppy-mir-326

AccessionMI0014894 (change log)
DescriptionPongo pygmaeus miR-326 stem-loop
Gene family MIPF0000143; mir-326
Stem-loop
   cuc        guu          c       uugu  a     -g  g 
5'    aucugucu   gggcuggagg agggccu    ga ggcgg  ug u
      ||||||||   |||||||||| |||||||    || |||||  || g
3'    uaggcgga   cccgaccucc ucccggg    cu ccgcu  ac c
   acu        -gc          u       ---u  -     ag  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr11: 70767541-70767635 [-]
intergenic
Database links

Mature sequence ppy-miR-326

Accession MIMAT0015830
Sequence

60 - 

ccucugggcccuuccuccag

 - 79

Get sequence
Evidence not experimental

References

1