Stem-loop sequence ppy-mir-325

AccessionMI0014893 (change log)
DescriptionPongo pygmaeus miR-325 stem-loop
Gene family MIPF0000147; mir-325
Stem-loop
   ----------a              cc   u    g c         uu gug 
5'            uacagugcuugguu  uag aggu u caguaagug  u   a
              ||||||||||||||  ||| |||| | |||||||||  |    
3'            gugucacgaacuaa  auc ucca g guuauucgu  a   c
   ggucucggauc              cu   c    g a         uu aug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chrX: 74500586-74500683 [-]
intergenic
Database links

Mature sequence ppy-miR-325

Accession MIMAT0015829
Sequence

16 - 

ccuaguagguguccaguaagugu

 - 38

Get sequence
Evidence not experimental

References

1