Stem-loop sequence ppy-mir-324

AccessionMI0014892 (change log)
DescriptionPongo pygmaeus miR-324 stem-loop
Gene family MIPF0000165; mir-324
Stem-loop
   cu      gc     c   u c   a     u   u  aaag 
5'   gacuau  cuccc gca c ccu gggca ugg gu    c
     ||||||  ||||| ||| | ||| ||||| ||| ||     
3'   cugaug  ggggg cgu g gga cccgu acc ca    u
   --      uu     u   c u   c     c   -  gagg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr17: 7234898-7234980 [-]
intergenic
Database links

Mature sequence ppy-miR-324-5p

Accession MIMAT0015827
Sequence

16 - 

cgcauccccuagggcauuggugu

 - 38

Get sequence
Evidence not experimental

Mature sequence ppy-miR-324-3p

Accession MIMAT0015828
Sequence

53 - 

acugccccaggugcugcugg

 - 72

Get sequence
Evidence not experimental

References

1