Stem-loop sequence ppy-mir-323

AccessionMI0014891 (change log)
DescriptionPongo pygmaeus miR-323 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   ---uu      u g        g u     gcgc  u    uua 
5'      gguacu g agagaggu g ccgug    gu cgcu   u
        |||||| | |||||||| | |||||    || ||||    
3'      cuauga c uuucucca c ggcac    ca gcgg   u
   cuaau      - g        g u     auua  c    uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 102587145-102587230 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-323
ppy-mir-379chr14: 102583478-102583544 [+]
ppy-mir-411chr14: 102584737-102584832 [+]
ppy-mir-299chr14: 102585203-102585265 [+]
ppy-mir-380chr14: 102586431-102586490 [+]
ppy-mir-1197chr14: 102586977-102587064 [+]
ppy-mir-323chr14: 102587145-102587230 [+]
ppy-mir-758chr14: 102587434-102587521 [+]
ppy-mir-329-1chr14: 102588199-102588278 [+]
ppy-mir-329-2chr14: 102588514-102588596 [+]
ppy-mir-494chr14: 102591073-102591153 [+]
ppy-mir-1193chr14: 102591485-102591597 [+]
ppy-mir-543chr14: 102593436-102593513 [+]
ppy-mir-495chr14: 102595205-102595283 [+]
Database links

Mature sequence ppy-miR-323-5p

Accession MIMAT0015825
Sequence

16 - 

aggugguccguggcgcguucgc

 - 37

Get sequence
Evidence not experimental

Mature sequence ppy-miR-323-3p

Accession MIMAT0015826
Sequence

51 - 

cacauuacacggucgaccucu

 - 71

Get sequence
Evidence not experimental

References

1