Stem-loop sequence ppy-mir-320c-2

AccessionMI0014888 (change log)
DescriptionPongo pygmaeus miR-320c-2 stem-loop
Gene family MIPF0000163; mir-320
Stem-loop
   --      uu       c     ag 
5'   cuucuc  uccaguu uuucc  a
     ||||||  ||||||| |||||   
3'   ggagag  gggucga aaggg  a
   ug      uu       a     uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr18: 35989131-35989180 [+]
intergenic
Database links

Mature sequence ppy-miR-320c

Accession MIMAT0015823
Sequence

31 - 

aaaagcuggguugagagggu

 - 50

Get sequence
Evidence not experimental

References

1