Stem-loop sequence ppy-mir-320c-1

AccessionMI0014887 (change log)
DescriptionPongo pygmaeus miR-320c-1 stem-loop
Gene family MIPF0000163; mir-320
Stem-loop
   uu       --aaaaugag        uu    -   c    cag 
5'   ugcauua          gccuucuc  ccca cuu uucc   a
     |||||||          ||||||||  |||| ||| ||||    
3'   auguagu          ugggagag  gggu gaa aagg   g
   --       aaaaaaaaga        uu    c   -    acu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr18: 33389943-33390028 [+]
intergenic
Database links

Mature sequence ppy-miR-320c

Accession MIMAT0015823
Sequence

50 - 

aaaagcuggguugagagggu

 - 69

Get sequence
Evidence not experimental

References

1