Stem-loop sequence ppy-mir-320b-2

AccessionMI0014886 (change log)
DescriptionPongo pygmaeus miR-320b-2 stem-loop
Gene family MIPF0000163; mir-320
Stem-loop
   --uguuauuuuuugucuucuaccua        ------g  u   ag        uu         c -  a 
5'                          agaauucu       uc cuu  gcuuucuc  cucaguuuu c ca a
                            ||||||||       || |||  ||||||||  ||||||||| | ||  
3'                          ucuuaaga       ag gaa  cgggagag  gggucgaaa g gu g
   aagggauagauuaacacagucucug        aaaaaaa  -   aa        uu         a a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 25489620-25489757 [+]
intergenic
Database links

Mature sequence ppy-miR-320b

Accession MIMAT0015822
Sequence

72 - 

aaaagcuggguugagagggcaa

 - 93

Get sequence
Evidence not experimental

References

1