Stem-loop sequence ppy-mir-320b-1

AccessionMI0014885 (change log)
DescriptionPongo pygmaeus miR-320b-1 stem-loop
Gene family MIPF0000163; mir-320
Stem-loop
   ---------------aauuaau       uu       c     ag 
5'                       cccucuc  ucuaguu uuccu  a
                         |||||||  ||||||| |||||   
3'                       gggagag  gggucga aagga  g
   uuaauuaaucaauuaaacaaac       uu       a     au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 111486776-111486854 [-]
intergenic
Database links

Mature sequence ppy-miR-320b

Accession MIMAT0015822
Sequence

39 - 

aaaagcuggguugagagggcaa

 - 60

Get sequence
Evidence not experimental

References

1