Stem-loop sequence ppy-mir-320a

AccessionMI0014884 (change log)
DescriptionPongo pygmaeus miR-320a stem-loop
Gene family MIPF0000163; mir-320
Stem-loop
         c   -ccuc         uu       c      g 
5' gcuucg ucc     cgccuucuc  cccgguu uucccg a
   |||||| |||     |||||||||  ||||||| ||||||  
3' uggagu agg     gcgggagag  gggucga aagggc g
         -   aaaaa         uu       a      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr8: 21813766-21813847 [-]
intergenic
Database links

Mature sequence ppy-miR-320a

Accession MIMAT0015821
Sequence

48 - 

aaaagcuggguugagagggcga

 - 69

Get sequence
Evidence not experimental

References

1