Stem-loop sequence ppy-mir-302d

AccessionMI0014882 (change log)
DescriptionPongo pygmaeus miR-302d stem-loop
Gene family MIPF0000071; mir-302
Stem-loop
     u u    u        u       ---c   ga 
5' cc c acuu aacaugga gcacuug    ugu  c
   || | |||| |||||||| |||||||    |||   
3' gg g ugag uuguaccu cgugaau    aca  a
     u -    u        u       aaaa   gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr4: 117393985-117394052 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-302d
ppy-mir-302bchr4: 117394496-117394571 [-]
ppy-mir-302cchr4: 117394361-117394428 [-]
ppy-mir-302dchr4: 117393985-117394052 [-]
ppy-mir-367chr4: 117393857-117393924 [-]
Database links

Mature sequence ppy-miR-302d

Accession MIMAT0015819
Sequence

44 - 

uaagugcuuccauguuugagugu

 - 66

Get sequence
Evidence not experimental

References

1