Stem-loop sequence ppy-mir-302c

AccessionMI0014881 (change log)
DescriptionPongo pygmaeus miR-302c stem-loop
Gene family MIPF0000071; mir-302
Stem-loop
       ug  uu             c    -g  u 
5' ccuu  cu  aacauggggguac ugcu  ug g
   ||||  ||  ||||||||||||| ||||  || a
3' ggag  ga  uuguaccuucgug auga  ac a
       gu  cu             a    aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr4: 117394361-117394428 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-302c
ppy-mir-302bchr4: 117394496-117394571 [-]
ppy-mir-302cchr4: 117394361-117394428 [-]
ppy-mir-302dchr4: 117393985-117394052 [-]
ppy-mir-367chr4: 117393857-117393924 [-]
Database links

Mature sequence ppy-miR-302c

Accession MIMAT0015818
Sequence

43 - 

uaagugcuuccauguuucagugg

 - 65

Get sequence
Evidence not experimental

References

1