Stem-loop sequence ppy-mir-302b

AccessionMI0014880 (change log)
DescriptionPongo pygmaeus miR-302b stem-loop
Gene family MIPF0000071; mir-302
Stem-loop
        cuuca   uu          ug   ucugug     a 
5' gcucc     acu  aacauggaag  cuu      acuuu a
   |||||     |||  ||||||||||  |||      |||||  
3' ugagg     uga  uuguaccuuc  gaa      ugaag a
        ----a   uu          gu   ------     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr4: 117394496-117394571 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-302b
ppy-mir-302bchr4: 117394496-117394571 [-]
ppy-mir-302cchr4: 117394361-117394428 [-]
ppy-mir-302dchr4: 117393985-117394052 [-]
ppy-mir-367chr4: 117393857-117393924 [-]
Database links

Mature sequence ppy-miR-302b

Accession MIMAT0015817
Sequence

50 - 

uaagugcuuccauguuuuaguag

 - 72

Get sequence
Evidence not experimental

References

1