Stem-loop sequence ppy-mir-301b

AccessionMI0014879 (change log)
DescriptionPongo pygmaeus miR-301b stem-loop
Gene family MIPF0000034; mir-130
Stem-loop
   ---g  g        c      ---g        a  gug u 
5'     cc caggugcu ugacga    guugcacu cu   c c
       || |||||||| ||||||    |||||||| ||   | u
3'     gg gucuacga acuguu    uaacguga ga   g g
   acca  -        a      auag        c  --a a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr22: 16950346-16950423 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-301b
ppy-mir-301bchr22: 16950346-16950423 [+]
ppy-mir-130bchr22: 16950667-16950748 [+]
Database links

Mature sequence ppy-miR-301b

Accession MIMAT0015816
Sequence

45 - 

cagugcaaugauauugucaaagc

 - 67

Get sequence
Evidence not experimental

References

1