Stem-loop sequence ppy-mir-299

AccessionMI0014877 (change log)
DescriptionPongo pygmaeus miR-299 stem-loop
Gene family MIPF0000186; mir-299
        a                      uu 
5' aagaa ugguuuaccgucccacauacau  u
   ||||| ||||||||||||||||||||||  g
3' uucuu gccaaauggcaggguguaugua  a
        c                      ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 102585203-102585265 [+]
Clustered miRNAs
< 10kb from ppy-mir-299
ppy-mir-379chr14: 102583478-102583544 [+]
ppy-mir-411chr14: 102584737-102584832 [+]
ppy-mir-299chr14: 102585203-102585265 [+]
ppy-mir-380chr14: 102586431-102586490 [+]
ppy-mir-1197chr14: 102586977-102587064 [+]
ppy-mir-323chr14: 102587145-102587230 [+]
ppy-mir-758chr14: 102587434-102587521 [+]
ppy-mir-329-1chr14: 102588199-102588278 [+]
ppy-mir-329-2chr14: 102588514-102588596 [+]
ppy-mir-494chr14: 102591073-102591153 [+]
ppy-mir-1193chr14: 102591485-102591597 [+]
ppy-mir-543chr14: 102593436-102593513 [+]
Database links

Mature sequence ppy-miR-299-5p

Accession MIMAT0015813

7 - 


 - 28

Get sequence
Evidence not experimental

Mature sequence ppy-miR-299-3p

Accession MIMAT0015814

39 - 


 - 60

Get sequence
Evidence not experimental
