Stem-loop sequence ppy-mir-298

AccessionMI0014876 (change log)
DescriptionPongo pygmaeus miR-298 stem-loop
Gene family MIPF0000206; mir-298
Stem-loop
   ---   gg    c      --      gc     uc -    g uu 
5'    uca  ucuu agcaga  agcagg  gguuc  c cagu g  u
      |||  |||| ||||||  ||||||  |||||  | |||| |  u
3'    agu  agga ucguuu  ucgucc  ucaag  g guca u  c
   ucg   -g    c      cg      ga     ga u    g uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr20: 56914694-56914781 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-298
ppy-mir-298chr20: 56914694-56914781 [-]
ppy-mir-296chr20: 56914083-56914162 [-]
Database links

Mature sequence ppy-miR-298

Accession MIMAT0015812
Sequence

11 - 

agcagaagcagggcgguucuccca

 - 34

Get sequence
Evidence not experimental

References

1