Stem-loop sequence ppy-mir-297

AccessionMI0014875 (change log)
DescriptionPongo pygmaeus miR-297 stem-loop
Gene family MIPF0000204; mir-297
Stem-loop
   ----------------u             c        g 
5'                  guauguaugugug augugcau u
                    ||||||||||||| ||||||||  
3'                  uauauauauauac uacaugug a
   acuauauacccaugcau             a        u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr4: 115566682-115566747 [-]
intergenic
Database links

Mature sequence ppy-miR-297

Accession MIMAT0015811
Sequence

4 - 

auguaugugugcaugugcaug

 - 24

Get sequence
Evidence not experimental

References

1