Stem-loop sequence ppy-mir-296

AccessionMI0014874 (change log)
DescriptionPongo pygmaeus miR-296 stem-loop
Gene family MIPF0000159; mir-296
Stem-loop
     ga      c        c  c         g   ugc 
5' ag  cccuuc ggagggcc cc cucaauccu uug   c
   ||  |||||| |||||||| || ||||||||| |||   u
3' uc  gggaag ccucucgg gg ggguuggga gac   a
     uc      u        a  u         -   uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr20: 56914083-56914162 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-296
ppy-mir-298chr20: 56914694-56914781 [-]
ppy-mir-296chr20: 56914083-56914162 [-]
Database links

Mature sequence ppy-miR-296-5p

Accession MIMAT0015809
Sequence

14 - 

agggcccccccucaauccugu

 - 34

Get sequence
Evidence not experimental

Mature sequence ppy-miR-296-3p

Accession MIMAT0015810
Sequence

48 - 

gaggguuggguggaggcucucc

 - 69

Get sequence
Evidence not experimental

References

1